|
miRBase |
|
Stem-loop sequence hsa-mir-4459 |
|||||
| Accession | MI0016805 | ||||
| Description | Homo sapiens miR-4459 stem-loop | ||||
| Gene family | MIPF0000579; mir-1273 | ||||
| Stem-loop |
a aggc ga --ga --- a cccagg ggag ggug gguu gc g |||||| |||| |||| |||| || u gggucc ccuc ucac cuag cg g g --ga ag ggug aac a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4459 |
|
| Accession | MIMAT0018981 |
| Sequence |
3 - ccaggaggcggaggagguggag - 24 |
| Deep sequencing | 30 reads, 13 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|