|
miRBase |
|
Stem-loop sequence hsa-mir-4457 |
|||||
| Accession | MI0016803 | ||||
| Description | Homo sapiens miR-4457 stem-loop | ||||
| Stem-loop |
g u g a a gaguac ccagucaauacc ugugaguu ga a |||||| |||||||||||| |||||||| || a cuuaug ggucaguuaugg acacuuaa cu g a c a - c |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4457 |
|
| Accession | MIMAT0018979 |
| Sequence |
43 - ucacaagguauugacuggcgua - 64 |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|