|
miRBase |
|
Stem-loop sequence hsa-mir-4454 |
|||||
| Accession | MI0016800 | ||||
| Description | Homo sapiens miR-4454 stem-loop | ||||
| Stem-loop |
--cc a - gagu - - aa gg uc c cacgg cac ca u || || | ||||| ||| || u cc ag g gugcc gug gu u acca - a aagu u c ac |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4454 |
|
| Accession | MIMAT0018976 |
| Sequence |
3 - ggauccgagucacggcacca - 22 |
| Deep sequencing | 5373 reads, 37 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|