Stem-loop sequence hsa-mir-4450

Accession MI0016795
Description Homo sapiens miR-4450 stem-loop
Stem-loop 
u   u      uu  a  ag     ag  cag 
 guc ggggau  gg ga  uggug  cg   g
 ||| ||||||  || ||  |||||  ||    
 cgg ucccug  cc cu  accac  gu   u
u   u      gu  c  cu     -g  uuc
Get sequence
Deep sequencing
16 reads, 2 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr4: 77494721-77494785 [+]
sense
OTTHUMT00000347373 ; SHROOM3-007; intron 1
OTTHUMT00000347373 ; SHROOM3-007; intron 1
OTTHUMT00000347373 ; SHROOM3-007; intron 1
OTTHUMT00000252408 ; SHROOM3-001; intron 2
OTTHUMT00000347378 ; SHROOM3-012; intron 2
OTTHUMT00000252408 ; SHROOM3-001; intron 2
OTTHUMT00000347378 ; SHROOM3-012; intron 2
OTTHUMT00000252408 ; SHROOM3-001; intron 2
OTTHUMT00000347378 ; SHROOM3-012; intron 2
ENST00000469923 ; SHROOM3-007; intron 1
ENST00000469923 ; SHROOM3-007; intron 1
ENST00000469923 ; SHROOM3-007; intron 1
ENST00000296043 ; SHROOM3-001; intron 2
ENST00000497440 ; SHROOM3-012; intron 2
ENST00000296043 ; SHROOM3-001; intron 2
ENST00000497440 ; SHROOM3-012; intron 2
ENST00000296043 ; SHROOM3-001; intron 2
ENST00000497440 ; SHROOM3-012; intron 2
Clustered miRNAs
< 10kb from hsa-mir-4450
hsa-mir-4450 chr4: 77494721-77494785 [+]
hsa-mir-548ah chr4: 77496704-77496779 [+]
Database links

Mature sequence hsa-miR-4450

Accession MIMAT0018971
Sequence

5 -  

uggggauuuggagaagugguga

 - 26

Get sequence
Deep sequencing 16 reads, 2 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).