Stem-loop sequence hsa-mir-548ag-2

AccessionMI0016794 (change log)
Symbol HGNC:MIR548AG2
DescriptionHomo sapiens miR-548ag-2 stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548ag-2
(170 sentences)

Stem-loop
   --              u    uc    a   a 
5'   ugcaaagguaauug gguu  ugcc uug a
     |||||||||||||| ||||  |||| |||  
3'   acguuuccauuaac ccaa  acgg aau a
   cg              u    ga    a   g 
Get sequence
Deep sequencing
2916 reads, 4.69 reads per million, 128 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 60564562-60564625 [+]
antisense
OTTHUMT00000079973 ; TAF4-006; intron 2
OTTHUMT00000472622 ; TAF4-009; intron 10
OTTHUMT00000079968 ; TAF4-001; intron 14
ENST00000474089 ; TAF4-006; intron 2
ENST00000436129 ; TAF4-009; intron 10
ENST00000252996 ; TAF4-001; intron 14
Database links

Mature sequence hsa-miR-548ag

Accession MIMAT0018969
Sequence

4 - 

aaagguaauugugguuucugc

 - 24

Get sequence
Deep sequencing5369 reads, 144 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).