Stem-loop sequence hsa-mir-4449

Accession MI0016792
Description Homo sapiens miR-4449 stem-loop
Stem-loop 
a  --agc     -       gg          g 
 gc     ccucg gcggccc  ggggcgggcg c
 ||     ||||| |||||||  ||||||||||  
 cg     ggagc cgucggg  cccugcccgu g
g  gacac     g       -g          g
Get sequence
Deep sequencing
467 reads, 30 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr4: 53578849-53578914 [+]
sense
OTTHUMT00000336530 ; KIAA0114-001; intron 1
OTTHUMT00000336532 ; KIAA0114-003; intron 1
OTTHUMT00000336530 ; KIAA0114-001; intron 1
OTTHUMT00000336532 ; KIAA0114-003; intron 1
OTTHUMT00000336530 ; KIAA0114-001; intron 1
OTTHUMT00000336532 ; KIAA0114-003; intron 1
ENST00000411630 ; KIAA0114-001; intron 1
ENST00000441504 ; KIAA0114-003; intron 1
ENST00000411630 ; DANCR-001; intron 1
ENST00000441504 ; DANCR-003; intron 1
ENST00000411630 ; DANCR-001; intron 1
ENST00000441504 ; DANCR-003; intron 1
Database links

Mature sequence hsa-miR-4449

Accession MIMAT0018968
Sequence

39 -  

cgucccggggcugcgcgaggca

 - 60

Get sequence
Deep sequencing 4 reads, 4 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).