Stem-loop sequence hsa-mir-4446

Accession MI0016789
Description Homo sapiens miR-4446 stem-loop
Gene family MIPF0001385; mir-4446
Stem-loop 
c  gu    u  c      uuc      cuuca 
 ug  ccau uc cugcca   ccuugg     a
 ||  |||| || ||||||   ||||||     u
 ac  ggua ag gacggu   gggacc     u
a  ug    c  u      --c      cucau
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 113313723-113313789 [+]
sense
OTTHUMT00000354232 ; SIDT1-010; intron 1
OTTHUMT00000354232 ; SIDT1-010; intron 1
OTTHUMT00000354232 ; SIDT1-010; intron 1
OTTHUMT00000317567 ; SIDT1-004; intron 3
OTTHUMT00000317567 ; SIDT1-004; intron 3
OTTHUMT00000317567 ; SIDT1-004; intron 3
OTTHUMT00000317564 ; SIDT1-001; intron 10
OTTHUMT00000317564 ; SIDT1-001; intron 10
OTTHUMT00000317564 ; SIDT1-001; intron 10
ENST00000480746 ; SIDT1-010; intron 1
ENST00000480746 ; SIDT1-010; intron 1
ENST00000480746 ; SIDT1-010; intron 1
ENST00000488390 ; SIDT1-004; intron 3
ENST00000488390 ; SIDT1-004; intron 3
ENST00000488390 ; SIDT1-004; intron 3
ENST00000264852 ; SIDT1-001; intron 10
ENST00000393830 ; SIDT1-201; intron 10
ENST00000264852 ; SIDT1-001; intron 10
ENST00000393830 ; SIDT1-201; intron 10
ENST00000264852 ; SIDT1-001; intron 10
ENST00000393830 ; SIDT1-201; intron 10
Database links

Mature sequence hsa-miR-4446-5p

Accession MIMAT0019233
Sequence

8 -  

auuucccugccauucccuuggc

 - 29

Get sequence
Evidence experimental; Solexa [2-3]
Predicted targets

Mature sequence hsa-miR-4446-3p

Accession MIMAT0018965
Sequence

43 -  

cagggcuggcagugacaugggu

 - 64

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [1-3]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).