Stem-loop sequence hsa-mir-4445

AccessionMI0016788 (change log)
Symbol HGNC:MIR4445
DescriptionHomo sapiens miR-4445 stem-loop
Literature search

1 open access papers mention hsa-mir-4445
(1 sentences)

Stem-loop
   u    gca                       uuu 
5'  uccu   gauuguuucuuuugccgugcaag   a
    ||||   |||||||||||||||||||||||    
3'  ggga   cuaacaaagaaaacggcacguuu   a
   u    gac                       uug 
Get sequence
Deep sequencing
35 reads, 100 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 109602828-109602897 [+]
intergenic
Database links

Mature sequence hsa-miR-4445-5p

Accession MIMAT0018963
Previous IDshsa-miR-4445
Sequence

8 - 

agauuguuucuuuugccgugca

 - 29

Get sequence
Deep sequencing27 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4445-3p

Accession MIMAT0018964
Previous IDshsa-miR-4445*
Sequence

44 - 

cacggcaaaagaaacaaucca

 - 64

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).