Stem-loop sequence hsa-mir-4439

Accession MI0016782
Description Homo sapiens miR-4439 stem-loop
Stem-loop 
---  -a    -                    ----------      
   cc  guga cugauaccuuggaggcauuu          uaucu 
   ||  |||| ||||||||||||||||||||          |||| a
   gg  cauu gacuauggaaucuccguaaa          auaga 
acc  ac    u                    cgaaacacac
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 225875178-225875257 [-]
sense
OTTHUMT00000331246 ; DOCK10-001; intron 1
OTTHUMT00000331159 ; DOCK10-012; intron 1
OTTHUMT00000331237 ; DOCK10-010; intron 1
OTTHUMT00000331238 ; DOCK10-011; intron 1
OTTHUMT00000331246 ; DOCK10-001; intron 1
OTTHUMT00000331159 ; DOCK10-012; intron 1
OTTHUMT00000331237 ; DOCK10-010; intron 1
OTTHUMT00000331238 ; DOCK10-011; intron 1
OTTHUMT00000331246 ; DOCK10-001; intron 1
OTTHUMT00000331159 ; DOCK10-012; intron 1
OTTHUMT00000331237 ; DOCK10-010; intron 1
OTTHUMT00000331238 ; DOCK10-011; intron 1
ENST00000258390 ; DOCK10-001; intron 1
ENST00000492369 ; DOCK10-012; intron 1
ENST00000435582 ; DOCK10-010; intron 1
ENST00000458608 ; DOCK10-011; intron 1
ENST00000258390 ; DOCK10-001; intron 1
ENST00000492369 ; DOCK10-012; intron 1
ENST00000435582 ; DOCK10-010; intron 1
ENST00000458608 ; DOCK10-011; intron 1
ENST00000258390 ; DOCK10-001; intron 1
ENST00000492369 ; DOCK10-012; intron 1
ENST00000435582 ; DOCK10-010; intron 1
ENST00000458608 ; DOCK10-011; intron 1
Database links

Mature sequence hsa-miR-4439

Accession MIMAT0018957
Sequence

4 -  

gugacugauaccuuggaggcau

 - 25

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).