Stem-loop sequence hsa-mir-4438

Accession MI0016781
Description Homo sapiens miR-4438 stem-loop
Stem-loop 
u                                       uugcc 
 aaguguaaacuuaaggacugucuuuucuaagccugugcc     u
 |||||||||||||||||||||||||||||||||||||||     u
 uucacauuugaauuucugacagaaaagauucggacacgg     u
c                                       uuucc
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 214622791-214622883 [+]
sense
OTTHUMT00000337126 ; SPAG16-007; intron 1
OTTHUMT00000337126 ; SPAG16-007; intron 1
OTTHUMT00000337126 ; SPAG16-007; intron 1
OTTHUMT00000337124 ; SPAG16-005; intron 8
OTTHUMT00000337124 ; SPAG16-005; intron 8
OTTHUMT00000337124 ; SPAG16-005; intron 8
OTTHUMT00000256601 ; SPAG16-001; intron 10
OTTHUMT00000256601 ; SPAG16-001; intron 10
OTTHUMT00000256601 ; SPAG16-001; intron 10
OTTHUMT00000337122 ; SPAG16-003; intron 12
OTTHUMT00000337122 ; SPAG16-003; intron 12
OTTHUMT00000337122 ; SPAG16-003; intron 12
ENST00000451561 ; SPAG16-007; intron 1
ENST00000451561 ; SPAG16-007; intron 1
ENST00000451561 ; SPAG16-007; intron 1
ENST00000452556 ; SPAG16-005; intron 8
ENST00000374309 ; SPAG16-202; intron 8
ENST00000452556 ; SPAG16-005; intron 8
ENST00000374309 ; SPAG16-202; intron 8
ENST00000452556 ; SPAG16-005; intron 8
ENST00000374309 ; SPAG16-202; intron 8
ENST00000331683 ; SPAG16-001; intron 10
ENST00000331683 ; SPAG16-001; intron 10
ENST00000331683 ; SPAG16-001; intron 10
ENST00000406979 ; SPAG16-003; intron 12
ENST00000406979 ; SPAG16-003; intron 12
ENST00000406979 ; SPAG16-003; intron 12
Database links

Mature sequence hsa-miR-4438

Accession MIMAT0018956
Sequence

56 -  

cacaggcuuagaaaagacagu

 - 76

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).