|
miRBase |
|
Stem-loop sequence hsa-mir-4435-2 |
|||||
| Accession | MI0016777 | ||||
| Description | Homo sapiens miR-4435-2 stem-loop | ||||
| Gene family | MIPF0001220; mir-4435 | ||||
| Stem-loop |
- ---aa ---a c aga a u gca uggcc gag ucacac ggg ugag g ||| ||||| ||| |||||| ||| |||| c cgu accgg cuc agugug ucc acuu a u agaca acga - acg - c |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4435 |
|
| Accession | MIMAT0018951 |
| Sequence |
5 - auggccagagcucacacagagg - 26 |
| Deep sequencing | 280 reads, 10 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|