Stem-loop sequence hsa-mir-4429

Accession MI0016768
Description Homo sapiens miR-4429 stem-loop
Gene family MIPF0001474; mir-4429
Stem-loop 
a   -agaaa  -     -cu         - ug  g 
 ggg      ag cuggg   gagaggcga c  gu u
 |||      || |||||   ||||||||| |  || c
 ccc      uc gacuc   cucucuguu g  ua u
a   gguccg  a     aac         u uu  a
Get sequence
Deep sequencing
441 reads, 31 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr2: 11680731-11680803 [-]
antisense
OTTHUMT00000280490 ; GREB1-001; intron 1
OTTHUMT00000280491 ; GREB1-002; intron 1
OTTHUMT00000280490 ; GREB1-001; intron 1
OTTHUMT00000280491 ; GREB1-002; intron 1
OTTHUMT00000280490 ; GREB1-001; intron 1
OTTHUMT00000280491 ; GREB1-002; intron 1
ENST00000381486 ; GREB1-001; intron 1
ENST00000263834 ; GREB1-002; intron 1
ENST00000381486 ; GREB1-001; intron 1
ENST00000263834 ; GREB1-002; intron 1
ENST00000381486 ; GREB1-001; intron 1
ENST00000263834 ; GREB1-002; intron 1
Database links

Mature sequence hsa-miR-4429

Accession MIMAT0018944
Sequence

7 -  

aaaagcugggcugagaggcg

 - 26

Get sequence
Deep sequencing 441 reads, 31 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).