Stem-loop sequence hsa-mir-4428

Accession MI0016767
Description Homo sapiens miR-4428 stem-loop
Gene family MIPF0001630; mir-4428
Stem-loop 
u    a   g       g    -      a   ua a 
 uggc ggu ccauguu ccug cuccuu cug  c c
 |||| ||| ||||||| |||| |||||| |||  |  
 accg ccg gguacaa gggc gaggaa ggu  g g
u    -   a       -    a      c   cg u
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 237634419-237634491 [+]
sense
OTTHUMT00000095402 ; RYR2-001; intron 17
OTTHUMT00000095402 ; RYR2-001; intron 17
OTTHUMT00000095402 ; RYR2-001; intron 17
ENST00000542537 ; RYR2-205; intron 16
ENST00000542537 ; RYR2-205; intron 16
ENST00000542537 ; RYR2-205; intron 16
ENST00000366574 ; RYR2-001; intron 17
ENST00000366574 ; RYR2-001; intron 17
ENST00000366574 ; RYR2-001; intron 17
ENST00000360064 ; RYR2-201; intron 18
ENST00000360064 ; RYR2-201; intron 18
ENST00000360064 ; RYR2-201; intron 18
Database links

Mature sequence hsa-miR-4428

Accession MIMAT0018943
Sequence

46 -  

caaggagacgggaacauggagc

 - 67

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).