Stem-loop sequence hsa-mir-548ac

Accession

MI0016762

Description

Homo sapiens miR-548ac stem-loop

Gene family

MIPF0000317; mir-548

Stem-loop

g                    u     -             uu 
 uauuagguuggugcaaaagu auugu gguuuuugcuauu  u
 |||||||||||||||||||| ||||| |||||||||||||  u
 augauccaaucacguuuuca uaacg ccaaaaacgguaa  u
g                    u     g             uu 

Deep sequencing

23 reads, 7 experiments

Genome context

• Coordinates (GRCh37.p5): chr1: 117102646-117102733 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000051442 ; RP4-655J12.5-001; intron 1

  OTTHUMT00000059036 ; CD58-001; intron 1

  OTTHUMT00000387904 ; CD58-005; intron 1

  OTTHUMT00000387905 ; CD58-004; intron 1

  OTTHUMT00000059037 ; CD58-002; intron 1

  OTTHUMT00000051442 ; RP4-655J12.5-001; intron 1

  OTTHUMT00000059036 ; CD58-001; intron 1

  OTTHUMT00000387904 ; CD58-005; intron 1

  OTTHUMT00000387905 ; CD58-004; intron 1

  OTTHUMT00000059037 ; CD58-002; intron 1

  OTTHUMT00000051442 ; RP4-655J12.5-001; intron 1

  OTTHUMT00000059036 ; CD58-001; intron 1

  OTTHUMT00000387904 ; CD58-005; intron 1

  OTTHUMT00000387905 ; CD58-004; intron 1

  OTTHUMT00000059037 ; CD58-002; intron 1

  ENST00000439755 ; RP4-655J12.5-001; intron 1

  ENST00000369489 ; CD58-001; intron 1

  ENST00000464088 ; CD58-005; intron 1

  ENST00000457047 ; CD58-004; intron 1

  ENST00000369487 ; CD58-002; intron 1

  ENST00000439755 ; RP4-655J12.5-001; intron 1

  ENST00000369489 ; CD58-001; intron 1

  ENST00000464088 ; CD58-005; intron 1

  ENST00000457047 ; CD58-004; intron 1

  ENST00000369487 ; CD58-002; intron 1

  ENST00000439755 ; RP4-655J12.5-001; intron 1

  ENST00000369489 ; CD58-001; intron 1

  ENST00000464088 ; CD58-005; intron 1

  ENST00000457047 ; CD58-004; intron 1

  ENST00000369487 ; CD58-002; intron 1

Database links

• ENTREZGENE: 100616384;MIR548AC

Mature sequence hsa-miR-548ac

• Accession: MIMAT0018938
• Sequence: 53 - caaaaaccggcaauuacuuuug - 74
• Deep sequencing: 3 reads, 1 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548ac
  • MIRDB:hsa-miR-548ac
  • TARGETMINER:hsa-miR-548ac

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).