|
miRBase |
|
Stem-loop sequence hsa-mir-4423 |
|||||
| Accession | MI0016760 | ||||
| Description | Homo sapiens miR-4423 stem-loop | ||||
| Gene family | MIPF0001587; mir-4423 | ||||
| Stem-loop |
a ca c -uu c uuu ucauguacug guugc uuuuug cc augcug a |||||||||| ||||| |||||| || |||||| aguguaugac caacg aaaaac gg uacgau a a aa - cac a ccg |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-4423-5p |
|
| Accession | MIMAT0019232 |
| Sequence |
13 - aguugccuuuuuguucccaugc - 34 |
| Deep sequencing | 1 reads, 1 experiments |
| Evidence | experimental; Solexa [2,4] |
| Predicted targets |
|
Mature sequence hsa-miR-4423-3p |
|
| Accession | MIMAT0018936 |
| Sequence |
49 - auaggcaccaaaaagcaacaa - 69 |
| Deep sequencing | 2 reads, 1 experiments |
| Evidence | experimental; Solexa [1-2,4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
| 2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
| 3 |
PMID:21911355
"miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades"
Nucleic Acids Res. 40:37-52(2012).
|
| 4 |
PMID:21807764
"Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome"
Hum Mol Genet. 20:4025-4040(2011).
|