Stem-loop sequence hsa-mir-4420

Accession MI0016757
Description Homo sapiens miR-4420 stem-loop
Stem-loop 
c   ug  -  ga     ugu   -   a      u   u 
 ucu  gu au  acauc   gug uuc ugucuc cug g
 |||  || ||  |||||   ||| ||| |||||| |||  
 aga  cg ug  uguag   cac gag gcaggg gac c
c   gu  a  uc     --u   u   a      -   a
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 31212003-31212079 [-]
sense
OTTHUMT00000010463 ; LAPTM5-001; intron 4
OTTHUMT00000010465 ; LAPTM5-003; intron 4
OTTHUMT00000010463 ; LAPTM5-001; intron 4
OTTHUMT00000010465 ; LAPTM5-003; intron 4
OTTHUMT00000010463 ; LAPTM5-001; intron 4
OTTHUMT00000010465 ; LAPTM5-003; intron 4
ENST00000294507 ; LAPTM5-001; intron 4
ENST00000464569 ; LAPTM5-003; intron 4
ENST00000424259 ; LAPTM5-201; intron 4
ENST00000294507 ; LAPTM5-001; intron 4
ENST00000464569 ; LAPTM5-003; intron 4
ENST00000424259 ; LAPTM5-201; intron 4
ENST00000294507 ; LAPTM5-001; intron 4
ENST00000464569 ; LAPTM5-003; intron 4
Database links

Mature sequence hsa-miR-4420

Accession MIMAT0018933
Sequence

54 -  

gucacugaugucuguagcugag

 - 75

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).