|
miRBase |
|
Stem-loop sequence hsa-mir-378f |
|||||
| Accession | MI0016756 | ||||
| Description | Homo sapiens miR-378f stem-loop | ||||
| Stem-loop |
g u -- a cau uu - gcuaaac ucagg c cugg cucc aguu cag gcu a ||||| | |||| |||| |||| ||| ||| gguuc g gacc gagg ucag guc cga a g u aa - --u -- a gcaagac |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-378f |
|
| Accession | MIMAT0018932 |
| Sequence |
52 - acuggacuuggagccagaag - 71 |
| Deep sequencing | 317212 reads, 21 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|