|
miRBase |
|
Stem-loop sequence hsa-mir-548ab |
|||||
| Accession | MI0016752 | ||||
| Description | Homo sapiens miR-548ab stem-loop | ||||
| Gene family | MIPF0000317; mir-548 | ||||
| Stem-loop |
au g a u uu a guuggugcaaaa uaauugugg uuuugc auuac gu u |||||||||||| ||||||||| |||||| ||||| || caaccacguuuu auuaacgcc aaaacg uaaug ua u -c g c - uu u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-548ab |
|
| Accession | MIMAT0018928 |
| Sequence |
11 - aaaaguaauuguggauuuugcu - 32 |
| Deep sequencing | 41 reads, 15 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|