Stem-loop sequence hsa-mir-548h-5

AccessionMI0016751 (change log)
Symbol HGNC:MIR548H5
DescriptionHomo sapiens miR-548h-5 stem-loop
Gene family MIPF0000317; mir-548
Literature search

43 open access papers mention hsa-mir-548h-5
(147 sentences)

Stem-loop
   a            c        u  -   c 
5'  caaaaguaaucg gguuuuug ca uua u
    |||||||||||| |||||||| || |||  
3'  guuuucguuggc ccaaaaau gu aau u
   c            a        -  c   u 
Get sequence
Deep sequencing
5564 reads, 2.16 reads per million, 139 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 131792172-131792231 [+]
intergenic
Database links

Mature sequence hsa-miR-548h-5p

Accession MIMAT0005928
Previous IDshsa-miR-548h
Sequence

3 - 

aaaaguaaucgcgguuuuuguc

 - 24

Get sequence
Deep sequencing29178 reads, 146 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).