|
miRBase |
|
Stem-loop sequence hsa-mir-548h-5 |
|||||
| Accession | MI0016751 | ||||
| Description | Homo sapiens miR-548h-5 stem-loop | ||||
| Gene family | MIPF0000317; mir-548 | ||||
| Stem-loop |
a c u - c caaaaguaaucg gguuuuug ca uua u |||||||||||| |||||||| || ||| guuuucguuggc ccaaaaau gu aau u c a - c u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-548h-5p |
|
| Accession | MIMAT0005928 |
| Previous IDs | hsa-miR-548h |
| Sequence |
3 - aaaaguaaucgcgguuuuuguc - 24 |
| Deep sequencing | 167 reads, 7 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|