Stem-loop sequence hsa-mir-378d-1

AccessionMI0016749 (change log)
Symbol HGNC:MIR378D1
DescriptionHomo sapiens miR-378d-1 stem-loop
Gene family MIPF0000168; mir-378
Literature search

194 open access papers mention hsa-mir-378d-1
(916 sentences)

Stem-loop
   a         --   uu    uu  ug 
5'  cuguuucug  ucc  guuc  gu  u
    |||||||||  |||  ||||  ||  u
3'  gacaaagac  agg  cagg  ca  a
   g         ug   uu    -u  uu 
Get sequence
Deep sequencing
2033206 reads, 3.42e+03 reads per million, 159 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 5923275-5923328 [-]
intergenic
Database links

Mature sequence hsa-miR-378d

Accession MIMAT0018926
Sequence

31 - 

acuggacuuggagucagaaa

 - 50

Get sequence
Deep sequencing7496537 reads, 160 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).