|
miRBase |
|
Stem-loop sequence hsa-mir-1268b |
|||||
| Accession | MI0016748 | ||||
| Description | Homo sapiens miR-1268b stem-loop | ||||
| Stem-loop |
a --- g ugg g g cccg ggc ugg ug gggu g |||| ||| ||| || |||| gggu ucg acc au uccg g a uga - uua g u |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-1268b |
|
| Accession | MIMAT0018925 |
| Sequence |
4 - cgggcgugguggugggggug - 23 |
| Deep sequencing | 568 reads, 28 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|