|
miRBase |
|
Stem-loop sequence hsa-mir-1254-2 |
|||||
| Accession | MI0016747 | ||||
| Description | Homo sapiens miR-1254-2 stem-loop | ||||
| Gene family | MIPF0000614; mir-1254 | ||||
| Stem-loop |
cuga ug aa cc u ag uau gcc g gcuggag ugcag g c g ||| | ||||||| ||||| | | a cgg c cgaucuc auguc c g u ---a gu -- -- - cu uac |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-1254 |
|
| Accession | MIMAT0005905 |
| Sequence |
4 - agccuggaagcuggagccugcagu - 27 |
| Deep sequencing | 395 reads, 14 experiments |
| Evidence | experimental; Solexa [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|