Stem-loop sequence hsa-mir-548o-2

Accession

MI0016746

Description

Homo sapiens miR-548o-2 stem-loop

Gene family

MIPF0000317; mir-548

Stem-loop

u                       u   --    a 
 ggugcaaaaguaauugcgguuuu gcc  auua a
 ||||||||||||||||||||||| |||  ||||  
 ccacguuuucauugacgucaaaa cgg  uaau a
c                       c   cg    g 

Deep sequencing

123 reads, 16 experiments

Genome context

• Coordinates (GRCh37.p5): chr20: 37145206-37145275 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000276804 ; RALGAPB-007; intron 2

  OTTHUMT00000276804 ; RALGAPB-007; intron 2

  OTTHUMT00000276804 ; RALGAPB-007; intron 2

  OTTHUMT00000276805 ; RALGAPB-008; intron 4

  OTTHUMT00000276805 ; RALGAPB-008; intron 4

  OTTHUMT00000276805 ; RALGAPB-008; intron 4

  OTTHUMT00000079191 ; RALGAPB-001; intron 7

  OTTHUMT00000079195 ; RALGAPB-005; intron 7

  OTTHUMT00000276803 ; RALGAPB-006; intron 7

  OTTHUMT00000079191 ; RALGAPB-001; intron 7

  OTTHUMT00000079195 ; RALGAPB-005; intron 7

  OTTHUMT00000276803 ; RALGAPB-006; intron 7

  OTTHUMT00000079191 ; RALGAPB-001; intron 7

  OTTHUMT00000079195 ; RALGAPB-005; intron 7

  OTTHUMT00000276803 ; RALGAPB-006; intron 7

  ENST00000461423 ; RALGAPB-007; intron 2

  ENST00000461423 ; RALGAPB-007; intron 2

  ENST00000461423 ; RALGAPB-007; intron 2

  ENST00000438490 ; RALGAPB-008; intron 4

  ENST00000438490 ; RALGAPB-008; intron 4

  ENST00000438490 ; RALGAPB-008; intron 4

  ENST00000262879 ; RALGAPB-001; intron 7

  ENST00000397042 ; RALGAPB-005; intron 7

  ENST00000397040 ; RALGAPB-006; intron 7

  ENST00000304939 ; RALGAPB-201; intron 7

  ENST00000537204 ; RALGAPB-203; intron 7

  ENST00000397038 ; RALGAPB-202; intron 7

  ENST00000262879 ; RALGAPB-001; intron 7

  ENST00000397042 ; RALGAPB-005; intron 7

  ENST00000397040 ; RALGAPB-006; intron 7

  ENST00000304939 ; RALGAPB-201; intron 7

  ENST00000537204 ; RALGAPB-203; intron 7

  ENST00000397038 ; RALGAPB-202; intron 7

  ENST00000262879 ; RALGAPB-001; intron 7

  ENST00000397042 ; RALGAPB-005; intron 7

  ENST00000397040 ; RALGAPB-006; intron 7

  ENST00000537204 ; RALGAPB-202; intron 7

  ENST00000397038 ; RALGAPB-201; intron 7

Database links

• ENTREZGENE: 100616190;MIR548O2

Mature sequence hsa-miR-548o-5p

• Accession: MIMAT0022738
• Sequence: 7 - aaaaguaauugcgguuuuugcc - 28
• Deep sequencing: 80 reads, 12 experiments
• Evidence: not experimental
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548o-5p
  • MIRDB:hsa-miR-548o-5p
  • TARGETMINER:hsa-miR-548o-5p

Mature sequence hsa-miR-548o-3p

• Accession: MIMAT0005919
• Previous IDs: hsa-miR-548o
• Sequence: 45 - ccaaaacugcaguuacuuuugc - 66
• Deep sequencing: 43 reads, 12 experiments
• Evidence: experimental; Solexa [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548o-3p
  • MICRORNA.ORG:hsa-miR-548o-3p
  • MIRDB:hsa-miR-548o-3p
  • RNA22-HSA:hsa-miR-548o-3p
  • TARGETMINER:hsa-miR-548o-3p
  • TARGETSCAN-VERT:hsa-miR-548o

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).