Stem-loop sequence hvu-MIR166b

AccessionMI0016742 (change log)
DescriptionHordeum vulgare miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

9 open access papers mention hvu-MIR166b
(32 sentences)

Stem-loop
           uu                aa    g   ggaauggcggauuc 
5' ggggaaug  gucugguccgagaccu  cacc ggc              a
   ||||||||  ||||||||||||||||  |||| |||               
3' ccccuuac  cggaccaggcuuuggg  gugg ucg              g
           uu                gg    a   aacgaaucgacguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR166b

Accession MIMAT0018500
Sequence

82 - 

ucggaccaggcuucauucccc

 - 102

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).
2
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).