Stem-loop sequence csi-MIR396c

AccessionMI0016735 (change log)
DescriptionCitrus sinensis miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention csi-MIR396c
(7 sentences)

Stem-loop
   -----   g           c              uucuuucuucuucuucuucuucuucuucuucuucuucuucuucuucu 
5'      cau uuuuuccacag uuucuugaacuucu                                               u
        ||| ||||||||||| ||||||||||||||                                                
3'      gua agaaggguguc aaagaacuugaaga                                               c
   aaacg   a           u              uuaucgacgucgaucgguguaguuuagcaucggauaauaaucuuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr1: 15270024-15270184 [-]
intergenic
Database links

Mature sequence csi-miR396c

Accession MIMAT0018493
Sequence

132 - 

uucaagaaaucugugggaag

 - 151

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).