Stem-loop sequence csi-MIR535a

AccessionMI0016726 (change log)
DescriptionCitrus sinensis miR535a stem-loop
Gene family MIPF0000136; MIR535
Literature search

2 open access papers mention csi-MIR535a
(5 sentences)

Stem-loop
   auuuuuucuaaugaacauucuuug     a  uuuu     u uau    a      ug --g      uauaauc    ccc 
5'                         uugca gg    cugau g   uguu cuuuuu  u   cagaua       cuug   a
                           ||||| ||    ||||| |   |||| ||||||  |   ||||||       ||||    
3'                         aacgu cu    gacug c   acga gagaga  a   guuugu       gaac   a
   -----------------------a     g  -uac     c cac    -      gu aca      uucaaca    uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 14822032-14822172 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR535a
csi-MIR535echr2: 14823918-14824011 [-]
csi-MIR535achr2: 14822032-14822172 [-]
Database links

Mature sequence csi-miR535a

Accession MIMAT0018484
Sequence

102 - 

ugacaaugagagagagcacac

 - 122

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).