Stem-loop sequence csi-MIR399a

AccessionMI0016712 (change log)
DescriptionCitrus sinensis miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention csi-MIR399a
(12 sentences)

Stem-loop
   cauugaggugcaugcaugcaguugcauauuaca      c      a        cu       u   acauccaucu     a 
5'                                  gggcaa aucucc uuggcagg  gcauacu auu          cauau u
                                    |||||| |||||| ||||||||  ||||||| |||          |||||  
3'                                  cccguu uagagg aaccgucu  cguguga uga          guaug a
   ----------uuuuauuuacgucuccuuaacgg      -      a        uc       c   ----cuucuu     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 2292782-2292936 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR399a
csi-MIR399achr2: 2292782-2292936 [+]
csi-MIR399fchr2: 2298474-2298644 [-]
Database links

Mature sequence csi-miR399a-5p

Accession MIMAT0037403
Sequence

34 - 

gggcaacaucuccauuggcagg

 - 55

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR399a-3p

Accession MIMAT0018469
Sequence

114 - 

ugccaaaggagauuugcccgg

 - 134

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).