Stem-loop sequence csi-MIR399d

Accession

MI0016711

Description

Citrus sinensis miR399d stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

a        u       c     ac        -  a   u    uauuggugcaauaaucagca 
 aagcaguu uagggca cucuu  uuggcaug ca ugg gauu                    u
 |||||||| ||||||| |||||  |||||||| || ||| ||||                     
 uucgucag gucccgu gagag  aaccguau gu acc cuaa                    u
c        u       u     ga        a  c   -    cuauagcuuaauugguuaua 

Mature sequence csi-miR399d

• Accession: MIMAT0018468
• Sequence: 100 - ugccaaaggagaguugcccug - 120
• Evidence: experimental; Solexa [1]

References

1. PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).