Stem-loop sequence csi-MIR399c

Accession

MI0016710

Description

Citrus sinensis miR399c stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

ucaauacaaagugacaa     uu   -    aa   u     c           u     ---u      -----        g 
                 ugugg  gag gaau  cag gcagu cuccuuuggcg gcaga    ugcaaa     gagauaau c
                 |||||  ||| ||||  ||| ||||| ||||||||||| |||||    ||||||     ||||||||  
                 acgcu  cuc cuua  guc cguua gaggaaaccgu ugucu    acguuu     cuuuauua a
------------gaucg     --   a    cc   c     a           u     uccu      acuua        u 

Mature sequence csi-miR399c

• Accession: MIMAT0018467
• Sequence: 109 - ugccaaaggagaauugcccug - 129
• Evidence: experimental; Solexa [1]

References

1. PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).