Dead miRNA entry

miRNA accession:
MI0016709
miRNA ID:
csi-MIR399e
Forward to:
MI0016713
Comment:
Sequences previously named MIR399e and MIR399c map to the same locus in the Csi_valencia_1.0 genome assembly. The entries are merged.

Previous miRNA entry

Stem-loop sequence csi-MIR399e

AccessionMI0016709 (change log)
DescriptionCitrus sinensis miR399e stem-loop
Gene family MIPF0000015; MIR399
Stem-loop
   ------------------------------------au      ccuucu     c    g  ---    ugcc    cauucac   c     uagu 
5'                                       uugcau      guuug caaa ga   gaau    cugc       ucu gcagc    u
                                         ||||||      ||||| |||| ||   ||||    ||||       ||| |||||    g
3'                                       aaugua      uaaac guuu uu   cuua    gacg       aga cguug    u
   guauaacuugagucuuaccauuuacuacuuuagcaaac      ----au     c    g  uaa    cucc    --accuu   a     uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence csi-miR399e

Accession MIMAT0018466
Sequence

18 - 

ugccaaaggagaauugcccug

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).