Stem-loop sequence csi-MIR396a

AccessionMI0016706 (change log)
DescriptionCitrus sinensis miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention csi-MIR396a
(1 sentences)

Stem-loop
   ------------------------c  --a         u   a c                  c   c   aauuuuccgaucgaua 
5'                          ga   gguccucuu gug u uuccacagcuuucuugaa ugu uug                c
                            ||   ||||||||| ||| | |||||||||||||||||| ||| |||                c
3'                          cu   uuaggagaa cau a aaggugucgaaagaacuu aca aac                g
   cuagagauaguuuucucucuaacua  ggu         u   c a                  a   c   ccuuaauuaguacgug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 3041218-3041370 [-]
intergenic
Database links

Mature sequence csi-miR396a-5p

Accession MIMAT0018463
Sequence

21 - 

uuccacagcuuucuugaacug

 - 41

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR396a-3p

Accession MIMAT0037398
Sequence

89 - 

auucaagaaagcuguggaaaa

 - 109

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).