|
miRBase |
|
Stem-loop sequence csi-MIR171a |
|
| Accession | MI0016699 |
| Description | Citrus sinensis miR171a stem-loop |
| Gene family | MIPF0000030; MIR171_1 |
| Stem-loop |
-uacu g a a u ua
cacg gauauuggugcgguucaau agaaa cgg gcucaa c
|||| ||||||||||||||||||| ||||| ||| ||||||
gugc cuauaaccgcgccgaguua uuuuu gcc cgaguu u
ucacc a g c u uu
|
Mature sequence csi-miR171a |
|
| Accession | MIMAT0018456 |
| Sequence |
70 - uugagccgcgccaauaucac - 89 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|