Stem-loop sequence csi-MIR166d

Accession

MI0016695

Description

Citrus sinensis miR166d stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

uuauaa      -aa    ----a   ga      uu       u    aaucaaauucauuauuug 
      ugaaaa   gggu     ucg  ccaggc  cauuccc ucag                  a
      ||||||   ||||     |||  ||||||  ||||||| ||||                   
      acuuuu   ucua     agc  gguuug  guaaggg aguu                  u
-----a      gga    cuggg   uc      uu       u    gguauuggagaguuuuuc 

Mature sequence csi-miR166d

• Accession: MIMAT0018452
• Sequence: 20 - ucggaccaggcuucauucccu - 40
• Evidence: experimental; Solexa [1]

References

1. PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).