Stem-loop sequence csi-MIR156

AccessionMI0016691
DescriptionCitrus sinensis miR156 stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         a cua            -         a   ag    uu     a 
5' cgagag g   cugacagaagag agugagcac cgc  guaa  guauu g
   |||||| |   |||||||||||| ||||||||| |||  ||||  |||||  
3' guuuuu c   gacugucuucuc ucgcucgug gug  cguu  uauaa a
         a ugc            c         c   ga    uc     a 
Get sequence
Deep sequencing
33458 reads, 4.99e+04 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?

Mature sequence csi-miR156

Accession MIMAT0018448
Sequence

13 - 

ugacagaagagagugagcac

 - 32

Get sequence
Deep sequencing25134 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).