Stem-loop sequence hsa-mir-548aa-2

Accession MI0016690
Description Homo sapiens miR-548aa-2 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
-------uuuua                 a  c                ac 
            uuagguuggugcaaaag aa ugugguuuuugccauu  u
            ||||||||||||||||| || ||||||||||||||||   
            aauccaaccacguuuuc uu acaccaaaaacgguaa  u
cucucccuucua                 a  a                cu
Get sequence
Deep sequencing
47 reads, 18 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 65467605-65467701 [+]
sense
OTTHUMT00000447193 ; PITPNC1-001; intron 1
OTTHUMT00000447194 ; PITPNC1-002; intron 1
OTTHUMT00000447195 ; PITPNC1-004; intron 1
OTTHUMT00000447196 ; PITPNC1-005; intron 2
ENST00000335257 ; PITPNC1-202; intron 1
ENST00000299954 ; PITPNC1-201; intron 1
ENST00000335257 ; PITPNC1-202; intron 1
ENST00000299954 ; PITPNC1-201; intron 1
ENST00000580974 ; PITPNC1-001; intron 1
ENST00000581322 ; PITPNC1-002; intron 1
ENST00000584471 ; PITPNC1-004; intron 1
ENST00000335257 ; PITPNC1-202; intron 1
ENST00000299954 ; PITPNC1-201; intron 1
ENST00000584554 ; PITPNC1-005; intron 2
Clustered miRNAs
< 10kb from hsa-mir-548aa-2
hsa-mir-548aa-2 chr17: 65467605-65467701 [+]
hsa-mir-548d-2 chr17: 65467605-65467701 [-]
Database links

Mature sequence hsa-miR-548aa

Accession MIMAT0018447
Sequence

55 -  

aaaaaccacaauuacuuuugcacca

 - 79

Get sequence
Deep sequencing 94 reads, 18 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).