Stem-loop sequence hsa-mir-548aa-2

AccessionMI0016690 (change log)
Symbol HGNC:MIR548AA2
DescriptionHomo sapiens miR-548aa-2 stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548aa-2
(170 sentences)

Stem-loop
   -------uuuua                 a  c                ac 
5'             uuagguuggugcaaaag aa ugugguuuuugccauu  u
               ||||||||||||||||| || ||||||||||||||||   
3'             aauccaaccacguuuuc uu acaccaaaaacgguaa  u
   cucucccuucua                 a  a                cu 
Get sequence
Deep sequencing
4334 reads, 1.43 reads per million, 140 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 67471489-67471585 [+]
sense
OTTHUMT00000450689 ; MAP2K6-001; intron 1
OTTHUMT00000450690 ; MAP2K6-003; intron 1
OTTHUMT00000450691 ; MAP2K6-005; intron 1
ENST00000590474 ; MAP2K6-001; intron 1
ENST00000586641 ; MAP2K6-003; intron 1
ENST00000359094 ; MAP2K6-005; intron 1
Clustered miRNAs
< 10kb from hsa-mir-548aa-2
hsa-mir-548aa-2chr17: 67471489-67471585 [+]
hsa-mir-548d-2chr17: 67471489-67471585 [-]
Database links

Mature sequence hsa-miR-548aa

Accession MIMAT0018447
Sequence

55 - 

aaaaaccacaauuacuuuugcacca

 - 79

Get sequence
Deep sequencing8078 reads, 140 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1