Stem-loop sequence hsa-mir-548aa-1

Accession MI0016689
Description Homo sapiens miR-548aa-1 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
-------cuu      uc           a  c             auuac 
          uauuag  uggugcaaaag aa ugugguuuuugcc     u
          ||||||  ||||||||||| || |||||||||||||      
          auaauc  accacguuuuc uu acaccaaaaacgg     u
uuuguucaau      ca           a  a             acauu
Get sequence
Deep sequencing
47 reads, 18 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr8: 124360274-124360370 [+]
antisense
OTTHUMT00000381765 ; ATAD2-003; intron 14
OTTHUMT00000381765 ; ATAD2-003; intron 14
OTTHUMT00000381765 ; ATAD2-003; intron 14
OTTHUMT00000381766 ; ATAD2-001; intron 15
OTTHUMT00000381768 ; ATAD2-005; intron 15
OTTHUMT00000381769 ; ATAD2-004; intron 15
OTTHUMT00000381766 ; ATAD2-001; intron 15
OTTHUMT00000381768 ; ATAD2-005; intron 15
OTTHUMT00000381769 ; ATAD2-004; intron 15
OTTHUMT00000381766 ; ATAD2-001; intron 15
OTTHUMT00000381768 ; ATAD2-005; intron 15
OTTHUMT00000381769 ; ATAD2-004; intron 15
OTTHUMT00000381767 ; ATAD2-002; intron 16
OTTHUMT00000381767 ; ATAD2-002; intron 16
OTTHUMT00000381767 ; ATAD2-002; intron 16
ENST00000517666 ; ATAD2-003; intron 14
ENST00000517666 ; ATAD2-003; intron 14
ENST00000517666 ; ATAD2-003; intron 14
ENST00000287394 ; ATAD2-001; intron 15
ENST00000519124 ; ATAD2-005; intron 15
ENST00000521496 ; ATAD2-004; intron 15
ENST00000287394 ; ATAD2-001; intron 15
ENST00000519124 ; ATAD2-005; intron 15
ENST00000521496 ; ATAD2-004; intron 15
ENST00000287394 ; ATAD2-001; intron 15
ENST00000519124 ; ATAD2-005; intron 15
ENST00000521496 ; ATAD2-004; intron 15
ENST00000521903 ; ATAD2-002; intron 16
ENST00000521903 ; ATAD2-002; intron 16
ENST00000521903 ; ATAD2-002; intron 16
Clustered miRNAs
< 10kb from hsa-mir-548aa-1
hsa-mir-548aa-1 chr8: 124360274-124360370 [+]
hsa-mir-548d-1 chr8: 124360274-124360370 [-]
Database links

Mature sequence hsa-miR-548aa

Accession MIMAT0018447
Sequence

55 -  

aaaaaccacaauuacuuuugcacca

 - 79

Get sequence
Deep sequencing 94 reads, 18 experiments
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).