Stem-loop sequence hsa-mir-548z

AccessionMI0016688 (change log)
Symbol HGNC:MIR548Z
DescriptionHomo sapiens miR-548z stem-loop
Gene family MIPF0000317; mir-548
Literature search

41 open access papers mention hsa-mir-548z
(141 sentences)

Stem-loop
   -------aag     a                   a a         c  a 
5'           uauua guuggugcaaaaguaauug g uuuuugcua ug a
             ||||| ||||||||||||||||||| | ||||||||| ||  
3'           auaau caaccacguuuucauuaac c aaaaacggu au a
   guaaccguag     c                   g c         a  g 
Get sequence
Deep sequencing
6864 reads, 3.03 reads per million, 132 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 64622509-64622605 [-]
antisense
OTTHUMT00000401052 ; RPS11P6-004; intron 2
ENST00000535684 ; RPS11P6-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-548z
hsa-mir-548cchr12: 64622509-64622605 [+]
hsa-mir-548zchr12: 64622509-64622605 [-]
Database links

Mature sequence hsa-miR-548z

Accession MIMAT0018446
Sequence

54 - 

caaaaaccgcaauuacuuuugca

 - 76

Get sequence
Deep sequencing6362 reads, 128 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1