Stem-loop sequence hsa-mir-550b-1

AccessionMI0016686 (change log)
Symbol HGNC:MIR550B1
DescriptionHomo sapiens miR-550b-1 stem-loop
Gene family MIPF0000334; mir-550
Literature search

12 open access papers mention hsa-mir-550b-1
(23 sentences)

Stem-loop
   a  - ac       ----agau                  ca  aucuua 
5'  ga g  uuguugg        gugccugagggaguaaga  cu      c
    || |  |||||||        ||||||||||||||||||  ||       
3'  cu c  aacgacc        cacggacucccucauucu  gg      a
   a  a ga       gaccacgu                  cg  acaaca 
Get sequence
Deep sequencing
3279 reads, 2.83 reads per million, 106 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 30289794-30289890 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-550b-1
hsa-mir-550a-1chr7: 30289794-30289890 [+]
hsa-mir-550b-1chr7: 30289794-30289890 [-]
Database links

Mature sequence hsa-miR-550b-2-5p

Accession MIMAT0022737
Sequence

16 - 

augugccugagggaguaagaca

 - 37

Get sequence
Deep sequencing5751 reads, 89 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-550b-3p

Accession MIMAT0018445
Previous IDshsa-miR-550b
Sequence

58 - 

ucuuacucccucaggcacug

 - 77

Get sequence
Deep sequencing792 reads, 49 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1