Stem-loop sequence hsa-mir-642b

AccessionMI0016685 (change log)
Symbol HGNC:MIR642B
DescriptionHomo sapiens miR-642b stem-loop
Gene family MIPF0000468; mir-642
Literature search

7 open access papers mention hsa-mir-642b
(27 sentences)

Stem-loop
              u                     aucc 
5' gaguugggagg ucccucuccaaaugugucuug    c
   ||||||||||| |||||||||||||||||||||    c
3' cucaacccucc agggagagguuuacacagaac    c
              c                     ccca 
Get sequence
Deep sequencing
1419 reads, 0.826 reads per million, 121 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 45674932-45675008 [-]
sense
OTTHUMT00000457554 ; TRAPPC6A-002; intron 1
OTTHUMT00000457555 ; TRAPPC6A-003; intron 1
OTTHUMT00000457556 ; TRAPPC6A-001; intron 1
OTTHUMT00000457557 ; TRAPPC6A-004; intron 1
OTTHUMT00000457558 ; TRAPPC6A-005; intron 1
ENST00000006275 ; TRAPPC6A-002; intron 1
ENST00000588062 ; TRAPPC6A-003; intron 1
ENST00000585934 ; TRAPPC6A-001; intron 1
ENST00000592647 ; TRAPPC6A-004; intron 1
ENST00000587818 ; TRAPPC6A-005; intron 1
antisense
OTTHUMT00000457536 ; MARK4-010; intron 1
ENST00000587566 ; MARK4-010; intron 1
Clustered miRNAs
< 10kb from hsa-mir-642b
hsa-mir-642bchr19: 45674932-45675008 [-]
hsa-mir-642achr19: 45674928-45675024 [+]
Database links

Mature sequence hsa-miR-642b-5p

Accession MIMAT0022736
Sequence

10 - 

gguucccucuccaaaugugucu

 - 31

Get sequence
Deep sequencing548 reads, 95 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-642b-3p

Accession MIMAT0018444
Previous IDshsa-miR-642b
Sequence

47 - 

agacacauuuggagagggaccc

 - 68

Get sequence
Deep sequencing870 reads, 98 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1