Stem-loop sequence hsa-mir-374c

AccessionMI0016684 (change log)
Symbol HGNC:MIR374C
DescriptionHomo sapiens miR-374c stem-loop
Gene family MIPF0000288; mir-374
Literature search

33 open access papers mention hsa-mir-374c
(57 sentences)

Stem-loop
   aca    caaug                    cu 
5'    cgga     auaauacaaccugcuaagug  a
      ||||     ||||||||||||||||||||   
3'    gccu     uauuauguuggacgauucac  g
   uga    accua                    ag 
Get sequence
Deep sequencing
10057 reads, 8.16 reads per million, 147 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 74218549-74218618 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-374c
hsa-mir-421chrX: 74218377-74218461 [-]
hsa-mir-374bchrX: 74218547-74218618 [-]
hsa-mir-374cchrX: 74218549-74218618 [+]
Database links

Mature sequence hsa-miR-374c-5p

Accession MIMAT0018443
Previous IDshsa-miR-374c
Sequence

13 - 

auaauacaaccugcuaagugcu

 - 34

Get sequence
Deep sequencing6567 reads, 144 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-374c-3p

Accession MIMAT0022735
Sequence

39 - 

cacuuagcagguuguauuauau

 - 60

Get sequence
Deep sequencing3490 reads, 127 experiments
Evidence not experimental
Predicted targets

References

1