Stem-loop sequence nlo-mir-9a

AccessionMI0016683 (change log)
DescriptionNasonia longicornis miR-9a stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   u    c   ca  uu       u        g     -  uug 
5'  ggcg gga  uu  cuuuggu aucuagcu uauga gu   g
    |||| |||  ||  ||||||| |||||||| ||||| ||    
3'  ccgc ccu  ag  gaggcca uggaucga auacu ca   u
   a    u   ag  uu       u        a     a  ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nlo-miR-9a

Accession MIMAT0018442
Sequence

15 - 

ucuuugguuaucuagcuguauga

 - 37

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).