Stem-loop sequence nlo-mir-34

AccessionMI0016676 (change log)
DescriptionNasonia longicornis miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   -   g    -----g       g u    u        agauu 
5'  ggc uguu      gcagugu g uagc gguugugu     a
    ||| ||||      ||||||| | |||| ||||||||      
3'  cug gcag      cgucacg c aucg ccagcacg     u
   g   -    uauuaa       g u    -        aaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nlo-miR-34

Accession MIMAT0018435
Sequence

9 - 

ggcagugugguuagcugguug

 - 29

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).