Stem-loop sequence nlo-mir-31a

AccessionMI0016675 (change log)
DescriptionNasonia longicornis miR-31a stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   ----------gaa   aa     c           ugcuu 
5'              ggc  gaugu ggcauagcuga     u
                |||  ||||| |||||||||||     u
3'              ccg  cuaca cugugucggcu     g
   acucgcaaaccga   ac     -           uuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nlo-miR-31a

Accession MIMAT0018434
Sequence

4 - 

ggcaagaugucggcauagcuga

 - 25

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).