Stem-loop sequence nlo-mir-184

AccessionMI0016666 (change log)
DescriptionNasonia longicornis miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   --c   -   aaa c         -      u   g   -  uaaa 
5'    gug ccu   g cccuuauca uucucc guc agu gu    a
      ||| |||   | ||||||||| |||||| ||| ||| ||    u
3'    cau ggg   c gggaauagu aagagg cag uca ca    u
   aga   u   agc c         c      -   g   g  ucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence nlo-miR-184

Accession MIMAT0018425
Sequence

54 - 

uggacggagaacugauaagggc

 - 75

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).