Stem-loop sequence ngi-mir-29b

AccessionMI0016642 (change log)
DescriptionNasonia giraulti miR-29b stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   aagaau      a c  a        c     -  c        -   acc 
5'       uaagau g ag gguacuga uucgg ug gugcuggg guu   g
         |||||| | || |||||||| ||||| || |||||||| |||    
3'       auucug c uc ucaugacu aaguu ac cacgaucc cga   a
   -----g      - -  a        a     u  -        g   acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-29b

Accession MIMAT0018401
Sequence

61 - 

uagcaccauuugaaaucagu

 - 80

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).