Stem-loop sequence ssc-mir-451

AccessionMI0016623 (change log)
DescriptionSus scrofa miR-451 stem-loop
Gene family MIPF0000148; mir-451
Literature search

16 open access papers mention ssc-mir-451
(42 sentences)

Stem-loop
   g  g ug     ca                 a 
5'  gg g  gcgag  aaccguuaccauuacug g
    || |  |||||  |||||||||||||||||  
3'  cc c  cguuc  uuggcaaugguaaugau u
   -  a gu     uc                 u 
Get sequence
Deep sequencing
17057 reads, 3.34e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 47177114-47177178 [+]
antisense
ENSSSCT00000019348 ; ssc-mir-451.1-201; 3'UTR (exon 10)
Clustered miRNAs
< 10kb from ssc-mir-451
ssc-mir-144chr12: 47176953-47177028 [+]
ssc-mir-451chr12: 47177114-47177178 [+]
Database links

Mature sequence ssc-miR-451

Accession MIMAT0018382
Sequence

14 - 

aaaccguuaccauuacugaguu

 - 35

Get sequence
Deep sequencing17048 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).