Stem-loop sequence ssc-mir-378-2

AccessionMI0016622 (change log)
DescriptionSus scrofa miR-378-2 stem-loop
Gene family MIPF0000168; mir-378
Literature search

20 open access papers mention ssc-mir-378-2
(97 sentences)

Stem-loop
   gu      c    agg    cagaacca  g    aa 
5'   gggccu cuga   cagg        uu ggug  a
     |||||| ||||   ||||        || ||||  a
3'   cccgga gacu   guuc        ag ucac  g
   -g      a    gag    --------  g    ga 
Get sequence
Deep sequencing
1023 reads, 133 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 38396700-38396767 [+]
intergenic
Database links

Mature sequence ssc-miR-378

Accession MIMAT0013868
Sequence

44 - 

acuggacuuggagucagaaggc

 - 65

Get sequence
Deep sequencing1823 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).