Stem-loop sequence ssc-mir-199a-1

AccessionMI0016621 (change log)
DescriptionSus scrofa miR-199a-1 stem-loop
Gene family MIPF0000040; mir-199
Literature search

18 open access papers mention ssc-mir-199a-1
(104 sentences)

Stem-loop
   u  -   gcc       u        c   --uca  ac 
5'  cc guc   ccagugu cagacuac ugu     gg  a
    || |||   ||||||| |||||||| |||     ||   
3'  gg cag   gguuaca gucugaug aca     cc  a
   g  u   auu       c        -   uguug  gu 
Get sequence
Deep sequencing
49673 reads, 8.89e+03 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 126105251-126105326 [-]
sense
ENSSSCT00000020622 ; ssc-mir-199a-1.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-199a-1
ssc-mir-199a-1chr9: 126105251-126105326 [-]
ssc-mir-214chr9: 126099461-126099570 [-]
Database links

Mature sequence ssc-miR-199a-5p

Accession MIMAT0013874
Sequence

9 - 

cccaguguucagacuaccuguuc

 - 31

Get sequence
Deep sequencing28303 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2-3]

Mature sequence ssc-miR-199a-3p

Accession MIMAT0013875
Sequence

48 - 

acaguagucugcacauugguua

 - 69

Get sequence
Deep sequencing68359 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2-4]

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).