Stem-loop sequence ssc-mir-126

AccessionMI0016619 (change log)
DescriptionSus scrofa miR-126 stem-loop
Gene family MIPF0000115; mir-126
Literature search

23 open access papers mention ssc-mir-126
(87 sentences)

Stem-loop
         - a           u       c cug   c 
5' cgacgg g cauuauuacuu ugguacg g   uga a
   |||||| | ||||||||||| ||||||| |   |||  
3' gcuguc c guaauaaugag gccaugc c   acu c
         g -           u       u -aa   u 
Get sequence
Deep sequencing
68671 reads, 1.37e+04 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 313734669-313734741 [+]
sense
ENSSSCT00000006406 ; EGFL7-201; intron 7
Database links

Mature sequence ssc-miR-126-5p

Accession MIMAT0018377
Previous IDsssc-miR-126*
Sequence

9 - 

cauuauuacuuuugguacgcg

 - 29

Get sequence
Deep sequencing40058 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2]

Mature sequence ssc-miR-126-3p

Accession MIMAT0018378
Previous IDsssc-miR-126
Sequence

46 - 

ucguaccgugaguaauaaugcg

 - 67

Get sequence
Deep sequencing28592 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).