Stem-loop sequence ssc-mir-30c-1

AccessionMI0016618 (change log)
DescriptionSus scrofa miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Literature search

17 open access papers mention ssc-mir-30c-1
(34 sentences)

Stem-loop
   ---c    ugc u       u   aca        ug gag 
5'     guag   g guaaaca ccu   cucucagc  u   c
       ||||   | ||||||| |||   ||||||||  |   u
3'     cguc   c cauuugu ggg   gagggucg  g   c
   guac    uuc u       u   --a        gu gag 
Get sequence
Deep sequencing
12145 reads, 2.35e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 157473595-157473674 [-]
sense
ENSSSCT00000004398 ; NFYC-201; intron 4
Clustered miRNAs
< 10kb from ssc-mir-30c-1
ssc-mir-30echr6: 157476655-157476734 [-]
ssc-mir-30c-1chr6: 157473595-157473674 [-]
Database links

Mature sequence ssc-miR-30c-5p

Accession MIMAT0002167
Previous IDsssc-miR-30c
Sequence

10 - 

uguaaacauccuacacucucagc

 - 32

Get sequence
Deep sequencing20344 reads, 15 experiments
Evidence experimental; cloned [1], Illumina [2-3]

Mature sequence ssc-miR-30c-1-3p

Accession MIMAT0022976
Sequence

49 - 

cugggagaggguuguuuacu

 - 68

Get sequence
Deep sequencing50 reads, 14 experiments
Evidence experimental; Illumina [2]

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).